Journal: Science Advances

Article Title: Histone decrotonylation plays a distinct role in HIV latency

doi: 10.1126/sciadv.aec0149

Figure Lengend Snippet: ( A ) Primary CD4 + T cell model of latency was activated with anti-CD3/CD28 Dynabeads. The percentage of GFP + cells was measured by flow cytometry (top). The levels of the ncNF-κB components p100 and p52, as well as ENL and CDYL were measured by Western blot (bottom) ( n = 3). The relative intensity was shown below with results normalized to dimethyl sulfoxide (DMSO) control. MW, molecular weight. ( B ) Primary CD4 + T cells from HIV-negative donors were infected with HIV-1 (SF162) and treated with or without 40 mM NaCr ( n = 3). HIV transcription levels were measured by reverse transcription quantitative polymerase chain reaction (RT-qPCR) targeting the HIV LTR, with results normalized to day 1 (left). The percentage of p24 + cells was measured by HIV-Flow assay (right). ( C ) TZM-bl luciferase reporter cells were transfected with empty vector (EV), Tat, wild-type (WT) HDAC3, or mutant HDAC3 (HDAC3-VRPP or HDAC3-Y298H), or Tat in combination with WT or mutant HDAC3 for 2 days ( n = 3). ( D ) A similar luciferase assay was performed with WT p300 and mutant p300-I1395G. Tat-induced HIV transcription was measured using a luciferase assay. Results are expressed as relative light units (RLU) and normalized to the EV control ( n = 4). The P values were determined using two-way analysis of variance (ANOVA) with multiple comparisons [(B), left], two-tailed unpaired Student’s t test [(B), right], or one-way ANOVA with multiple comparisons (C). Error bars represent SD; * P < 0.05; *** P < 0.001; **** P < 0.0001.

Article Snippet: We first confirmed that 1 to 20 nM YX968 (MedChemExpress) selectively degraded HDAC3 and HDAC8, but not HDAC1 and HDAC2, in 2D10 cells, unless the dosage was higher than 50 nM (fig. S5D).

Techniques: Flow Cytometry, Western Blot, Control, Molecular Weight, Infection, Reverse Transcription, Real-time Polymerase Chain Reaction, Quantitative RT-PCR, Luciferase, Transfection, Plasmid Preparation, Mutagenesis, Two Tailed Test

Journal: Science Advances

Article Title: Histone decrotonylation plays a distinct role in HIV latency

doi: 10.1126/sciadv.aec0149

Figure Lengend Snippet: ( A ) A modified version of the HDAC3 crystal structure (PDB: 4A69) with the DAD and IP 4 removed compared with the AF3 predicted HDAC3 crystal structure. ( B ) Docking the selected HDACis into the enzyme pocket of HDAC3. ( C and D ) Primary CD4 + T cells were treated with the indicated HDACis for 0.5 hours. Total histone H3 and histone PTMs were detected by Western blot. The relative intensity was shown below with results normalized to DMSO control. HDAC3/NCOR1 (0.3 mg/ml) was incubated with crotonylated histone H3 ( E ) or acetylated histone H3 ( F ) in the presence or absence of different concentrations of citarinostat. Total histone H3 and histone PTMs were detected by Western blot. For (C) and (D), DMSO was used as a negative control. Results are representative of three biological replicate experiments with consistent results.

Article Snippet: We first confirmed that 1 to 20 nM YX968 (MedChemExpress) selectively degraded HDAC3 and HDAC8, but not HDAC1 and HDAC2, in 2D10 cells, unless the dosage was higher than 50 nM (fig. S5D).

Techniques: Modification, Western Blot, Control, Incubation, Negative Control

Journal: Science Advances

Article Title: Histone decrotonylation plays a distinct role in HIV latency

doi: 10.1126/sciadv.aec0149

Figure Lengend Snippet: Structural overlay of HDAC1, HDAC2, HDAC3, and HDAC8 bound to SAHA ( A ) and citarinostat ( B ). HDAC1, green; HDAC2, cyan; HDAC3, wheat; HDAC8, pink. HDAC2 (0.05 mg/ml) ( C ) or HDAC8 (0.4 mg/ml) ( D ) were incubated with crotonylated histone H3 or acetylated histone H3 in the presence or absence of different concentrations of citarinostat. Total histone H3 and histone PTMs were detected by Western blot. ( E ) HDAC3 was knocked out in 2D10 cells via CRISPR-Cas9, using a nontargeting guide RNA as the control, and the cells were cultured for 5 days. NT, nontargeting control; KO, knock out. ( F ) In a separate experiment, 2D10 cells were pretreated for 24 hours with DMSO or 20 nM YX968, an HDAC3/8 dual PROTAC. For both experimental series, cells were subsequently treated for 30 min with the following HDACis: DMSO (vehicle), 350 nM SAHA, 0.1 μM citarinostat, 5 μM RGFP966, or 5 μM mod-RGFP966. Histones were then extracted and analyzed by Western blot for specific PTMs and total histone H3 levels.

Article Snippet: We first confirmed that 1 to 20 nM YX968 (MedChemExpress) selectively degraded HDAC3 and HDAC8, but not HDAC1 and HDAC2, in 2D10 cells, unless the dosage was higher than 50 nM (fig. S5D).

Techniques: Incubation, Western Blot, CRISPR, Control, Cell Culture, Knock-Out

Journal: Science Advances

Article Title: Histone decrotonylation plays a distinct role in HIV latency

doi: 10.1126/sciadv.aec0149

Figure Lengend Snippet: ( A ) Citarinostat, RGFP966, and mod-RGFP966 were docked against the artificial intelligence–generated enzyme pocket of HDAC3. Single-letter abbreviations for the amino acid residues are as follows: D, Asp; Q, Gln; R, Arg. ( B ) Primary CD4 + T cells were nucleofected with 1 μg of EV or HDAC3 WT/D57A/Q113A/R265A/R301A. After 5 to 7 days, total histone H3 and histone PTMs were detected by Western blot. The relative intensity was shown below with results normalized to WT HDAC3. PanKbu, butyryllysine; PanKlac, L-lactyllysine; PanKpr, propionyllysine.

Article Snippet: We first confirmed that 1 to 20 nM YX968 (MedChemExpress) selectively degraded HDAC3 and HDAC8, but not HDAC1 and HDAC2, in 2D10 cells, unless the dosage was higher than 50 nM (fig. S5D).

Techniques: Generated, Western Blot

Journal: The Febs Journal

Article Title: Butyrate suppresses mucosal inflammation in inflammatory bowel disease primarily through HDAC3 inhibition in monocytes and macrophages

doi: 10.1111/febs.70289

Figure Lengend Snippet: MCT1, GPR109A, and HDAC3 expression in intestinal mucosa of healthy controls and inflammatory bowel disease patients. (A) Gene expression of SLC16A1 , HCAR2 , and HDAC3 from bulk RNA‐sequencing data in colon biopsies of healthy controls (HC n = 48), non‐inflamed (NI) and inflamed (I) mucosa from patients with Crohn's disease (CD; NI = 162, I = 73), and ulcerative colitis (UC; NI = 145 and I = 121). The Y ‐axis in the graphs represents normalized gene counts, obtained through trimmed mean of M ‐values normalization method of raw counts from high‐throughput sequencing. These normalized values are used to depict relative gene expression levels, enabling comparison across samples. Data are presented as medians and interquartile ranges. Statistical analysis: Kruskal–Wallis test. * P < 0.05; ** P < 0.01, *** P < 0.001; **** P < 0.0001. (B) Representative immunofluorescence images and quantification of MCT1, GPR109A and HDAC3 distribution in the epithelium and lamina propria (LP) (image resolution: 0.50 μm per pixel). Positive immunoreactivity is indicated by white arrows for colonic epithelium and white arrowheads for lamina propria (LP) mononuclear cells, evaluated in mucosa areas from HC ( n = 3), and NI and I mucosa from CD and UC patients ( n = 3 per group) from the Chilean research center. Images for MCT1 and GPR109A were zoomed from a 20× magnification, while images for HDAC3, were zoomed from a 40× magnification (scale bar: 50 μm).

Article Snippet: Tissue and organoid samples were blocked with PBS 1× containing 1% BSA for 30 min at room temperature and incubated overnight at 4 °C with the following primary antibodies: rabbit anti‐human HCAR2 (GPR109A) (1 : 50, Cat No HPA028660, polyclonal), rabbit anti‐human SLC16A1 (MCT1) (1 : 250 for tissue or 1 : 100 for organoids, Cat No HPA003324, polyclonal) (both from Sigma‐Aldrich, Zwijndrecht, The Netherlands), or rabbit anti‐human HDAC3 (1 : 200, Cat No 10255‐1‐AP polyclonal, Proteintech, Rosemont, IL, USA).

Techniques: Expressing, Gene Expression, RNA Sequencing, Next-Generation Sequencing, Comparison, Immunofluorescence

Journal: The Febs Journal

Article Title: Butyrate suppresses mucosal inflammation in inflammatory bowel disease primarily through HDAC3 inhibition in monocytes and macrophages

doi: 10.1111/febs.70289

Figure Lengend Snippet: SLC16A1 , HCAR2 , and HDAC3 expression in colon epithelial and immune cells. Dot plots of single‐cell RNA‐seq (scRNA‐seq) data show genes in columns and cells in rows. The dot size represents the percentage of cells expressing the gene, and the color indicates the scaled mean expression. Healthy controls (HC), Crohn's disease (CD), ulcerative colitis (UC), and non‐inflamed (NI) or inflamed (I) mucosa are indicated as specified in the datasets. ScRNA‐seq datasets for SLC16A1 , HCAR2 , and HDAC3 are shown in (A, C) for colon epithelial cells and (B, D) for colon immune cells. Data were obtained from the studies of (A, B) Kong et al . (colon tissue from CD patients and HC) and (C, D) Smillie et al . (colon tissue from UC patients and HC) .

Article Snippet: Tissue and organoid samples were blocked with PBS 1× containing 1% BSA for 30 min at room temperature and incubated overnight at 4 °C with the following primary antibodies: rabbit anti‐human HCAR2 (GPR109A) (1 : 50, Cat No HPA028660, polyclonal), rabbit anti‐human SLC16A1 (MCT1) (1 : 250 for tissue or 1 : 100 for organoids, Cat No HPA003324, polyclonal) (both from Sigma‐Aldrich, Zwijndrecht, The Netherlands), or rabbit anti‐human HDAC3 (1 : 200, Cat No 10255‐1‐AP polyclonal, Proteintech, Rosemont, IL, USA).

Techniques: Expressing, RNA Sequencing

Journal: The Febs Journal

Article Title: Butyrate suppresses mucosal inflammation in inflammatory bowel disease primarily through HDAC3 inhibition in monocytes and macrophages

doi: 10.1111/febs.70289

Figure Lengend Snippet: Regulation of SLC16A1 , HCAR2 , and HDAC3 expression by butyrate in ex vivo ‐cultured biopsies. mRNA levels of SLC16A1 (A), HCAR2 (B) and HDAC3 (C) were measured in ex vivo ‐cultured biopsies from colonic mucosa of healthy controls (HC) ( n = 3) and non‐inflamed (NI, n = 6) and inflamed (I, n = 8) inflammatory bowel disease (IBD) tissues, determined by TaqMan RT‐qPCR. Statistical analysis: Wilcoxon matched‐pairs signed‐rank test for NI vs. I tissue and control vs. butyrate treatment (B, C); Mann–Whitney test for HC vs. IBD (B). * P < 0.05.

Article Snippet: Tissue and organoid samples were blocked with PBS 1× containing 1% BSA for 30 min at room temperature and incubated overnight at 4 °C with the following primary antibodies: rabbit anti‐human HCAR2 (GPR109A) (1 : 50, Cat No HPA028660, polyclonal), rabbit anti‐human SLC16A1 (MCT1) (1 : 250 for tissue or 1 : 100 for organoids, Cat No HPA003324, polyclonal) (both from Sigma‐Aldrich, Zwijndrecht, The Netherlands), or rabbit anti‐human HDAC3 (1 : 200, Cat No 10255‐1‐AP polyclonal, Proteintech, Rosemont, IL, USA).

Techniques: Expressing, Ex Vivo, Cell Culture, Quantitative RT-PCR, Control, MANN-WHITNEY

Journal: The Febs Journal

Article Title: Butyrate suppresses mucosal inflammation in inflammatory bowel disease primarily through HDAC3 inhibition in monocytes and macrophages

doi: 10.1111/febs.70289

Figure Lengend Snippet: Butyrate induces GPR109A and HDAC3 mRNA expression and reduces IL‐6 and TNF‐α mRNA levels in human inflammatory monocytes in a GPR109A‐independent manner. mRNA levels of HCAR2 and HDAC3 were determined by RT‐qPCR in human peripheral blood monocytes (A, C) and THP‐1 macrophages (B, D) ( n = 4 or n = 6) treated with butyrate in the presence or absence of lipopolysaccharide (LPS) + IFN‐γ (0.1 + 20 ng·mL −1 ) for 6 h. Human peripheral blood monocytes were treated with butyrate (2 m m ) in the presence or absence of LPS + IFN‐γ (0.1 + 20 ng·mL −1 ) for 6 h, with or without pretreatment of 100 μ m mepenzolate bromide (MB) or Pertussis toxin (PT), for 1 h. mRNA levels of (E) IL6 and (F) TNFA ( n = 3 or n = 4) were determined by RT‐qPCR. Statistical analysis: One‐way ANOVA with Bonferroni post‐test (B–D); Wilcoxon matched‐pairs signed‐rank test (A); and paired t ‐test (E, F). * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.

Article Snippet: Tissue and organoid samples were blocked with PBS 1× containing 1% BSA for 30 min at room temperature and incubated overnight at 4 °C with the following primary antibodies: rabbit anti‐human HCAR2 (GPR109A) (1 : 50, Cat No HPA028660, polyclonal), rabbit anti‐human SLC16A1 (MCT1) (1 : 250 for tissue or 1 : 100 for organoids, Cat No HPA003324, polyclonal) (both from Sigma‐Aldrich, Zwijndrecht, The Netherlands), or rabbit anti‐human HDAC3 (1 : 200, Cat No 10255‐1‐AP polyclonal, Proteintech, Rosemont, IL, USA).

Techniques: Expressing, Quantitative RT-PCR

Journal: The Febs Journal

Article Title: Butyrate suppresses mucosal inflammation in inflammatory bowel disease primarily through HDAC3 inhibition in monocytes and macrophages

doi: 10.1111/febs.70289

Figure Lengend Snippet: Butyrate induces histone acetylation in THP‐1 macrophages and monocytes and reduces IL‐6 content in human inflammatory monocytes similar as the HDAC3 antagonist SAHA. Acetylation on histone H3 lysine 9 (H3K9ac) was determined intracellularly by flow cytometry in (A) THP‐1 macrophages ( n = 3) and in (B) human peripheral blood monocytes ( n = 5) treated with butyrate or SAHA in the presence or absence of lipopolysaccharide (LPS) + IFN‐γ for 6 h. Secreted IL‐6 (C) and TNF (D) levels by human monocytes ( n = 5) were analyzed using cytometric bead array (CBA). Statistical analysis: Wilcoxon matched‐pairs signed‐rank test and paired t ‐test * P < 0.05; ** P < 0.01; *** P < 0.001.

Article Snippet: Tissue and organoid samples were blocked with PBS 1× containing 1% BSA for 30 min at room temperature and incubated overnight at 4 °C with the following primary antibodies: rabbit anti‐human HCAR2 (GPR109A) (1 : 50, Cat No HPA028660, polyclonal), rabbit anti‐human SLC16A1 (MCT1) (1 : 250 for tissue or 1 : 100 for organoids, Cat No HPA003324, polyclonal) (both from Sigma‐Aldrich, Zwijndrecht, The Netherlands), or rabbit anti‐human HDAC3 (1 : 200, Cat No 10255‐1‐AP polyclonal, Proteintech, Rosemont, IL, USA).

Techniques: Flow Cytometry

Journal: iScience

Article Title: Evolutionary adaptations of TRPA1 thermosensitivity and skin thermoregulation in vertebrates

doi: 10.1016/j.isci.2025.113369

Figure Lengend Snippet: Identification and expression of trpv and trpa family members in Xenopus laevis melanophores (A) Molecular phylogenetic analysis by the maximum likelihood method of Trpv and Trpa family members (not to scale) of the predicted proteins from the genes found in the X. laevis genome. The name, gene number and chromosome localization are indicated. Brackets denote genes duplicated and maintained on the long (L) and short (S) chromosomes, with single copy genes indicated with an asterisk. (B and C) Representative RT-PCR analysis of mRNA expression in stage 43/44 whole embryos (B), and for isolated tails and MEX cells (C). The expressed mRNAs (L or S) identified after sequencing are indicated. Representative example of 3 independent samples; N = 3. (D–F) Immunohistochemistry for Trpv1 (D, F) or Trpa1 (E, F) and the Tyrosinase related protein 1 (Tyrp1) in consecutive sections (D, E), and in MEX cells (F). DAPI staining (blue) was used to visualize cell nuclei and facilitate the overlapping of adjacent sections in D and E. Boxed areas are shown enlarged (D′ or E′ and D″ or E″). Scale bar in D = 100 μm. Immunolabel indicates co-localization in melanophores (M) of the skin (S) of Tyrp1 (arrows) with the Trp channels. Note, adjacent sections were used as all antibodies were generated in rabbits. Note that Tyrp1 is localized to melanosomes while the Trp channels are in the plasma membrane. Scale bar in F = 10 μm.

Article Snippet: Anti human TRPA1 (rabbit polyclonal) , Biorbyt , Cat #: orb575403.

Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Isolation, Sequencing, Immunohistochemistry, Staining, Immunolabeling, Generated, Clinical Proteomics, Membrane

Journal: iScience

Article Title: Evolutionary adaptations of TRPA1 thermosensitivity and skin thermoregulation in vertebrates

doi: 10.1016/j.isci.2025.113369

Figure Lengend Snippet: Melanosome dispersion is affected by a Trpa1 agonist and antagonist (A and B) Tadpoles (Stage 43/44) or MEX cells were treated with agonists (A) or antagonists (B) against the indicated Trp channels. The agonists were added at 16°C and maintained at that temperature, while antagonists were added at 16°C, and the embryos were then switched to 32°C for 45 min. Data points ( n = 9 embryos or n = 6 MEX cells pictures) and a boxplot (25 th to 75 th percentile) are represented; A representative study from three ( N = 3) independent experiments is shown, with Capsaicin ( N = 2). Statistical significances for the different compounds are indicated against the control without the drug at the same temperature. ns; non significant. ∗; p < 0.05. ∗∗; p < 0.01.∗∗∗; p < 0.001. ∗∗∗∗; p < 0.0001.

Article Snippet: Anti human TRPA1 (rabbit polyclonal) , Biorbyt , Cat #: orb575403.

Techniques: Dispersion, Control

Journal: iScience

Article Title: Evolutionary adaptations of TRPA1 thermosensitivity and skin thermoregulation in vertebrates

doi: 10.1016/j.isci.2025.113369

Figure Lengend Snippet: Melanosome dispersion induced by temperature is mediated by Trpa1 (A) MEX cells transfected with a GFP-expression vector (control) or siRNA oligonucleotides, sense (S) or antisense (AS) against Trpa1, together with GFP in a 5:1 ratio. GFP-expressing cells had aggregated (orange arrow) or dispersed (white arrow) pigment. Representative images show the merge between GFP (pink), DAPI (yellow), and brightfield (BF). Scale bar = 10 μm. (B) Quantification of melanosome dispersion in GFP-expressing cells observed by shifting cells from 16°C to 32°C for 1 h after 48 h of transfection. Data are expressed as the percentage of GFP positive cells with dispersed melanosomes relative to the total number of GFP positive MEX cells ( N = 3; n = 20 pictures). Numbers in the bars indicate the counted cells. p value indicates a Fisher’s exact test comparing S and AS at 32°C.

Article Snippet: Anti human TRPA1 (rabbit polyclonal) , Biorbyt , Cat #: orb575403.

Techniques: Dispersion, Transfection, Expressing, Plasmid Preparation, Control

Journal: iScience

Article Title: Evolutionary adaptations of TRPA1 thermosensitivity and skin thermoregulation in vertebrates

doi: 10.1016/j.isci.2025.113369

Figure Lengend Snippet: Representative TRPA1 Structure and Phylogenetic Diagram of Related Taxa (A) Schematic of the secondary structure of human TRPA1: The 16 ankyrin repeat domains (ARD) at the amino terminus are numbered, followed by the linkers, the six transmembrane domains (S1 to S6), the TRP like domain, and the coiled coil domain at the carboxy terminus. (B) Related taxa (classes or superfamily) of vertebrates with similar TRPA1 “thermosensation” as determined by electrophysiological data obtained from the literature are color coded (heat, red; cold, blue; temperature insensitive, black; and unknown, dashed circles). Extant species of interest shown separated (see Materials and Methods) into 26 groups corresponding to the colored taxonomic clades indicated on the right. Evolutionary years (millions), dividing different eras, are approximated and are indicated on the left. Teleost-specific duplication [TSD] is indicated in yellow. Blue circles denote the age of the oldest preserved fossils with fur or feathers with insulation capacity, likely related to the advent of homeothermy (groups 10 to 26). Groups 1 to 9 are ectotherms. Groups 14 to 23 (square) are analyzed in and contain several specific examples of marine mammals, while groups 24 to 26 (square) are analyzed in and contain taxonomic groups with cold-activated TRPA1 (group 25, some rodents) and temperature-insensitive TRPA1 (group 24, Sciuromorpha and lagomorphs; group 26, primates).

Article Snippet: Anti human TRPA1 (rabbit polyclonal) , Biorbyt , Cat #: orb575403.

Techniques: Insulation

Journal: iScience

Article Title: Evolutionary adaptations of TRPA1 thermosensitivity and skin thermoregulation in vertebrates

doi: 10.1016/j.isci.2025.113369

Figure Lengend Snippet: Comparative phylogenetic analysis of TRPA1 domains for three marine mammals with terrestrial relatives Molecular phylogenetic analysis by the maximum-likelihood method based on the JTT matrix model was performed with the amino acid sequences of species shown in . The trees with the highest log-likelihood are shown to scale. Note the scale changes between the more recent evolutionary event containing bears (polar bear; brown bear; black bear and panda) and seals (Pinnipeds; groups 21–23) with respect to the analysis with manatees (Sirenia; groups 14 to 16) and whales (Cetacea; groups 17 to 20). The full length TRPA1 sequence, the region containing the sensor with the ankyrin repeat domain (ARD) 1 to 9, ARDs 10 to 16, and the transmembrane domains (S1 to S6) were used for the analysis. Numbers in the right (mean ± SD) indicate the phylogenetic distance relative to that for full-length TRPA1. Lack of standard deviation indicates only one species with TRPA1 data available. Evolutionary analyses were conducted in MEGA X.

Article Snippet: Anti human TRPA1 (rabbit polyclonal) , Biorbyt , Cat #: orb575403.

Techniques: Sequencing, Standard Deviation

Journal: iScience

Article Title: Evolutionary adaptations of TRPA1 thermosensitivity and skin thermoregulation in vertebrates

doi: 10.1016/j.isci.2025.113369

Figure Lengend Snippet: Phylogenetic divergence and alignment of the S5 Region of Glires and Primates (groups 23 to 26) as indicated in (A) Phylogenetic analysis (not to scale) from all major rodent clades modified from Blanga-Kanfi and co-workers based on six nuclear genes. (B) S5 region alignment containing the glycine residue (G878) present in several rodents (Group 25: Myomorphas, Hystricomorphas, and Castorimorphas) that is essential for cold sensitivity. The substitution of this residue with valine (V) in primates (Group 26) and lagomorphs (Group 24: rabbits, hares, and pikas) correlates with, where data are available, instances of thermal differences in TRPA1 sensitivity. Substituting human V878 with G878, however, does not restore cold sensitivity. Note that TRPA1 in the rodent squirrel (Sciuromorpha) is temperature insensitive and contains V at amino acid 878 instead of G. Demonstrated electrophysiological data for TRPA1 thermal sensitivity (cold, blue; insensitive, black) are indicated on the right.

Article Snippet: Anti human TRPA1 (rabbit polyclonal) , Biorbyt , Cat #: orb575403.

Techniques: Modification, Residue

Journal: Cell Death Discovery

Article Title: HDAC3 genetic and pharmacologic inhibition radiosensitizes fusion positive rhabdomyosarcoma by promoting DNA double-strand breaks

doi: 10.1038/s41420-024-02115-y

Figure Lengend Snippet: A Biochemical data of MC4448 against HDAC1, −3, −4, −6 and −8 at three fixed doses (0.01, 0.3, and 7 µM). B Dose-response curves of RH30 and RH4 cells treated with increasing concentration of MC4448. Graph represents the mean of three independent experiment ±SEM. C Representative western blot ( n = 3) of RH30 and RH4 treated with MC4448 IC50 for 24 h showing levels of acetylated H3. Vinculin was used as loading control. D Growth curve analysis of RH30 and RH4 cells treated as in ( C ). n = 3 independent experiments, data presented as mean values ± SD, Student’s two-tailed t test. E Heatmap depicting dose response effect of MC4448 treatment for 72 h on FP-RMS cells (RH30 and RH4), and Normal Human Skeletal Muscle Myoblast (HSMM) and Normal Fetal Human Lung Fibroblast (MRC5).

Article Snippet: RNA interference was performed with 100 nM final concentration siRNAs against human HDAC1 (GCCGGUCAUGUCCAAAGUAAU), HDAC2 (GUUGCUCGAUGUUGGACAUAU), HDAC3 (CCUGCAUUACGGUCUCUAUAA), HDAC8 (UUACGAUUGCGACGGAAAUUU) or with a non-targeting siRNA as control (SIC001) (Sigma-Aldrich, St Louis, MO, USA) using Oligofectamine (Invitrogen, Carlsbad, CA).

Techniques: Concentration Assay, Western Blot, Control, Two Tailed Test

Journal: Journal of Medicinal Chemistry

Article Title: Exploration of Hydrazide-Based HDAC8 PROTACs for the Treatment of Hematological Malignancies and Solid Tumors

doi: 10.1021/acs.jmedchem.4c00836

Figure Lengend Snippet: HDAC1/2/3/8 Inhibitory Activities of PROTAC Z16 a

Article Snippet: Human recombinant C-terminal FLAG-tag, C-terminal His-tag HDAC1 (BPS Bioscience, Catalog#: 50051), Human recombinant C-terminal FLAG-tag HDAC2 (BPS Bioscience, Catalog#: 50052), human recombinant C-terminal His-tag HDAC3/NcoR2 (BPS Bioscience, Catalog#: 50003) and human recombinant C-terminal His-tag HDAC8 (BPS Bioscience, Catalog#: 50008) were diluted in assay buffer (25 mM Tris-HCl, pH 8.0, 137 mM NaCl, 2.7 mM KCl, 1 mM MgCl 2 , and 0.1 mg/mL BSA), HDAC1(1.87 ng/μL), HDAC2 (1.87 ng/μL), HDAC3 (0.89 ng/μL), and HDAC8 (1.16 ng/μL).

Techniques:

Journal: American Journal of Human Genetics

Article Title: De novo missense variants in HDAC3 leading to epigenetic machinery dysfunction are associated with a variable neurodevelopmental disorder

doi: 10.1016/j.ajhg.2024.06.015

Figure Lengend Snippet: HDAC3 variants near catalytic sites display deficient HDAC activity (A) Western blot analyses were conducted on HEK293T cells transduced with either empty vector (EV), FLAG-tagged wild-type (WT) HDAC3, or selected HDAC3 variants (p.Ala110Thr, p.Gly267Ser, p.Leu266Ser, and p.Arg359Cys) using a lentiviral expression system. The detection of HDAC3; FLAG-HDAC3; acetylated histones H3K9, H3K27, and H3; total H3; NCoR1; NCoR2; and GAPDH (loading control) was visualized. Notably, increased acetylation levels of H3K9, H3K27, and H3 were observed in p.Gly267Ser and p.Leu266Ser variants (red dashed rectangle), indicating a defective deacetylation function. (B) Quantitative analysis of acetylation levels at histone sites H3K9, H3K27, and H3 from (A). The p.Gly267Ser and p.Leu266Ser variants show increased acetylation levels compared to the WT at H3K9, H3K27, and H3, indicating impaired histone deacetylation function. ∗∗ p < 0.01, ∗∗∗ p < 0.001, ∗∗∗∗ p < 0.0001, n = 3/data point. Data are plotted as mean ± SD. (C) HDAC assays were performed using H3K27ac-mononucleosomes or H3/H4Kac-mononucleosomes as substrates at various concentrations (0, 60, 120 nM) in conjunction with 100 nM of acetylated mononucleosomes. The deacetylation activities of complexes comprising either the NCoR1 DAD domain-HDAC3 WT or variant forms were measured for histone H3K27ac, H3ac, and H4ac in triplicate ( n = 3/data point). The results are plotted as mean ± SD. The p.Gly267Ser and p.Leu266Ser variants do not result in histone acetylation levels, indicating defective HDAC activity. In contrast, the p.Ala110Thr and p.Arg359Cys variants retain deacetylation activities comparable to the WT form.

Article Snippet: HDAC assays were performed with HDAC buffer (10 mM Tris-HCl at pH 8.0, 150 mM NaCl, and 10% glycerol), recombinant H3K27-acetylated mononucleosomes or recombinant H3K4,9,14,18-/H4K5,8,12,16-acetylated mononucleosomes (EpiCypher), and recombinant human NCoR1 DAD domain-HDAC3 complexes.

Techniques: Activity Assay, Western Blot, Transduction, Plasmid Preparation, Expressing, Control, Variant Assay

Journal: American Journal of Human Genetics

Article Title: De novo missense variants in HDAC3 leading to epigenetic machinery dysfunction are associated with a variable neurodevelopmental disorder

doi: 10.1016/j.ajhg.2024.06.015

Figure Lengend Snippet: Proteomic analysis using co-immunoprecipitation reveals reduced interactions between HDAC3 variants and the subunits of NCoR and CoREST complexes (A) Volcano plots of protein interaction profiles for four selected HDAC3 variants (p.Ala110Thr, p.Gly267Ser, p.Leu266Ser, and p.Arg359Cys) compared to HDAC3 wild-type (WT) in HEK293T cells. The plots highlight important proteins involved in the NCoR and CoREST complexes or the proteasome pathway, with the x axis representing the log 2 fold change (FC) and the y axis showing the −log 10 p value (measured in triplicate for each data point). (B) Schematic presentation of the NCoR and CoREST complexes, with the position of HDAC3 and its interacting subunits within each complex. (C) A heatmap summarizes the log 2 FC in protein interactions for HDAC3 variants relative to WT. Each column represents a distinct protein, as highlighted in (A), and each row corresponds to the four tested HDAC3 variants. Blue shades denote decreased, and red shades indicate increased interaction strength. The data show decreased interactions with subunits of the NCoR and CoREST complexes and contrasted with an increased interaction tendency with subunits of the proteasome pathway, illustrating variant-specific effects on HDAC3 function and complex integrity. (D) Bar graphs display quantified protein levels using the intensity-based absolute quantification (iBAQ) method for three major proteins: NCoR1, NCoR2, and KDM1A. The data reveal a consistent reduction in association with the HDAC3 variants for these proteins. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗∗ p < 0.0001. Data are plotted as mean ± SD ( n = 3/data point).

Article Snippet: HDAC assays were performed with HDAC buffer (10 mM Tris-HCl at pH 8.0, 150 mM NaCl, and 10% glycerol), recombinant H3K27-acetylated mononucleosomes or recombinant H3K4,9,14,18-/H4K5,8,12,16-acetylated mononucleosomes (EpiCypher), and recombinant human NCoR1 DAD domain-HDAC3 complexes.

Techniques: Immunoprecipitation, Variant Assay, Quantitative Proteomics

Journal: American Journal of Human Genetics

Article Title: De novo missense variants in HDAC3 leading to epigenetic machinery dysfunction are associated with a variable neurodevelopmental disorder

doi: 10.1016/j.ajhg.2024.06.015

Figure Lengend Snippet: Impaired interactions of HDAC3 variants with NCoR1/2 and KDM1A (A) Silver-stained SDS-PAGE analysis demonstrating the protein complexes co-immunoprecipitated (IP) with FLAG-tagged HDAC3 from HEK293T cells. Tested conditions include an empty vector (EV), wild type (WT), and HDAC3 variants (p.Ala110Thr, p.Gly267Ser, p.Leu266Ser, and p.Arg359Cys). The band intensities corresponding to the NCoR complex (indicated by red arrow) and KDM1A (indicated by blue arrow) are reduced in the variant forms. Specifically, the p.Ala110Thr shows a remarkable decrease in NCoR complex band intensity (red rectangle), and all variants exhibit diminished KDM1A bands (blue rectangle). (B) Western blot analyses confirm the differential co-immunoprecipitation of NCoR1, NCoR2, and KDM1A with HDAC3 variants, using an anti-FLAG antibody for immunoprecipitation. FLAG-tagged HDAC3 and GAPDH serve as a reference for protein levels and loading control, respectively. (C) Quantification of co-immunoprecipitated NCoR1, NCoR2, and KDM1A, normalized to the WT HDAC3 levels, based on the Western blot data in (B). This panel quantitatively depicts the significant interaction deficits in the p.Ala110Thr and p.Arg359Cys variants with NCoR1, NCoR2, and KDM1A, despite these variants retaining deacetylase activity comparable to WT. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗∗ p < 0.0001. Data are plotted as mean ± SD ( n = 3/data point).

Article Snippet: HDAC assays were performed with HDAC buffer (10 mM Tris-HCl at pH 8.0, 150 mM NaCl, and 10% glycerol), recombinant H3K27-acetylated mononucleosomes or recombinant H3K4,9,14,18-/H4K5,8,12,16-acetylated mononucleosomes (EpiCypher), and recombinant human NCoR1 DAD domain-HDAC3 complexes.

Techniques: Staining, SDS Page, Immunoprecipitation, Plasmid Preparation, Variant Assay, Western Blot, Control, Histone Deacetylase Assay, Activity Assay